ABOUT THIS RECORDspecies: Arabidopsis thaliana
miRNA family: miR161.1
source: miRBase, original name: ath-MIR161 (MI0000193)
Taxonomy by NCBI:
Arabidopsis thaliana Arabidopsis Brassicaceae Brassicales malvids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TGAAAGTGACTACATCGGGGT miRNA* CCTGGTTTAGTCACTTTCACT mismatches: 1 bulges: 0 |
pre-miRNA
TGCTTGATCTCGGTTTTTGACCAGTTTATTGCGTCGATCAATGCATTGAAAGTGACTACATCGGGGTTCCGATTTTTTTTGTTCTTCATATGATGAAGCG
GAAACAGTAATCAACCCTGGTTTAGTCACTTTCACTGCATTAATCAATGCATTTGTAAAAAGAGGGAAAAGCA
dot-bracket secondary structure
.((((..((((..((((((..(((.....(((((.(((.((((((.((((((((((((.(((((((((..((((....(((((((((((...))))))..
..))))).))))))))))))).)))))))))))).)))))).))).))))).)))))))))..)))).)))).
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
degradome data
download this record
evidence: cloned, Northern, 5'RACE, 454
references
[1] German MA, Pillay M, Jeong DH, Hetawal A, Luo S, Janardhanan P, Kannan V, Rymarquis LA, Nobuta K, German R, De Paoli E, Lu C, Schroth G, Meyers BC, Green PJ, Nat Biotechnol. 26:941-946(2008)., "Global identification of microRNA-target RNA pairs by parallel analysis of RNA ends"
[2] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[3] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[4] Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP, Cell. 110:513-520(2002)., "Prediction of plant microRNA targets"
[5] Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP, Genes Dev. 16:1616-1626(2002)., "MicroRNAs in plants"
[6] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[7] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
TGCTTGATCTCGGTTTTTGACCAGTTTATTGCGTCGATCAATGCATTGAAAGTGACTACATCGGGGTTCCGATTTTTTTTGTTCTTCATATGATGAAGCG
GAAACAGTAATCAACCCTGGTTTAGTCACTTTCACTGCATTAATCAATGCATTTGTAAAAAGAGGGAAAAGCA
dot-bracket secondary structure
.((((..((((..((((((..(((.....(((((.(((.((((((.((((((((((((.(((((((((..((((....(((((((((((...))))))..
..))))).))))))))))))).)))))))))))).)))))).))).))))).)))))))))..)))).)))).
SIMILARITIES| miRBase ath-MIR161: 6e-81 PMRD ath-miRf10691-akr: 3e-58 microPC miR161: 5e-38 | UniProt no hits RFAM no hits |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
degradome data
download this record
evidence: cloned, Northern, 5'RACE, 454
references
[1] German MA, Pillay M, Jeong DH, Hetawal A, Luo S, Janardhanan P, Kannan V, Rymarquis LA, Nobuta K, German R, De Paoli E, Lu C, Schroth G, Meyers BC, Green PJ, Nat Biotechnol. 26:941-946(2008)., "Global identification of microRNA-target RNA pairs by parallel analysis of RNA ends"
[2] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[3] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[4] Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP, Cell. 110:513-520(2002)., "Prediction of plant microRNA targets"
[5] Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP, Genes Dev. 16:1616-1626(2002)., "MicroRNAs in plants"
[6] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[7] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
