ABOUT THIS RECORDspecies: Arabidopsis thaliana
miRNA family: MIR171_1
source: miRBase, original name: ath-MIR170 (MI0000213)
Taxonomy by NCBI:
Arabidopsis thaliana Arabidopsis Brassicaceae Brassicales malvids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TGATTGAGCCGTGTCAATATC miRNA* TATTGGCCTGGTTCACTCAGA mismatches: 2 bulges: 0 |
pre-miRNA
CGAGAGAGTCCCTCTGATATTGGCCTGGTTCACTCAGATTCTCTTTTACTAACTCATCTGATTGAGCCGTGTCAATATCTCAGTCCTCTCTCG
dot-bracket secondary structure
((((((((..(....(((((((((.(((((((.((((((................)))))).))))))).)))))))))...)..))))))))
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
degradome data
download this record
evidence: cloned, Northern, 5'RACE, 454
deep sequencing data evidence
references
[1] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[2] Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP, Cell. 110:513-520(2002)., "Prediction of plant microRNA targets"
[3] Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP, Genes Dev. 16:1616-1626(2002)., "MicroRNAs in plants"
[4] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[5] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
CGAGAGAGTCCCTCTGATATTGGCCTGGTTCACTCAGATTCTCTTTTACTAACTCATCTGATTGAGCCGTGTCAATATCTCAGTCCTCTCTCG
dot-bracket secondary structure
((((((((..(....(((((((((.(((((((.((((((................)))))).))))))).)))))))))...)..))))))))
SIMILARITIES| miRBase aly-MIR170: 3e-38 PMRD ath-miR171a: 0.000000000001 microPC miR171: 0.000004 | UniProt no hits RFAM MIR171_1: 2e-42 |
MOREmiRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
degradome data
download this record
evidence: cloned, Northern, 5'RACE, 454
deep sequencing data evidence
references
[1] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[2] Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP, Cell. 110:513-520(2002)., "Prediction of plant microRNA targets"
[3] Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP, Genes Dev. 16:1616-1626(2002)., "MicroRNAs in plants"
[4] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[5] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
