ABOUT THIS RECORDspecies: Arabidopsis thaliana
miRNA family: MIR172
source: miRBase, original name: ath-MIR172a (MI0000215)
Taxonomy by NCBI:
Arabidopsis thaliana Arabidopsis Brassicaceae Brassicales malvids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA AGAATCTTGATGATGCTGCAT miRNA* GTGGCATCATCAAGATTCACA mismatches: 4 bulges: 0 |
pre-miRNA
TGCTGTGGCATCATCAAGATTCACATCTGTTGATGGACGGTGGTGATTCACTCTCCACAAAGTTCTCTATGAAAATGAGAATCTTGATGATGCTGCATCG
GC
dot-bracket secondary structure
.(.((..(((((((((((((((.(((...(((.((((.(((((....))))).)))))))..(((.....))).))).)))))))))))))))..)).).
..
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, 5'RACE, 454, MPSS
deep sequencing data evidence
references
[1] Mette MF, van der Winden J, Matzke M, Matzke AJ, Plant Physiol. 130:6-9(2002)., "Short RNAs can identify new candidate transposable element families in Arabidopsis"
[2] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[3] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[4] Park W, Li J, Song R, Messing J, Chen X, Curr Biol. 12:1484-1495(2002)., "CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana"
[5] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[6] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
TGCTGTGGCATCATCAAGATTCACATCTGTTGATGGACGGTGGTGATTCACTCTCCACAAAGTTCTCTATGAAAATGAGAATCTTGATGATGCTGCATCG
GC
dot-bracket secondary structure
.(.((..(((((((((((((((.(((...(((.((((.(((((....))))).)))))))..(((.....))).))).)))))))))))))))..)).).
..
SIMILARITIES| miRBase aly-MIR172a: 2e-48 PMRD ath-miRf11033-akr: 4e-53 microPC miR172: 0.0000003 | UniProt no hits RFAM mir-172: 6e-52 |
Identical with: ath-miR172a from PMRD (MNEST046983) |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, 5'RACE, 454, MPSS
deep sequencing data evidence
references
[1] Mette MF, van der Winden J, Matzke M, Matzke AJ, Plant Physiol. 130:6-9(2002)., "Short RNAs can identify new candidate transposable element families in Arabidopsis"
[2] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[3] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[4] Park W, Li J, Song R, Messing J, Chen X, Curr Biol. 12:1484-1495(2002)., "CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana"
[5] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[6] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
