ABOUT THIS RECORDspecies: Arabidopsis thaliana
miRNA family: MIR390
source: miRBase, original name: ath-MIR390b (MI0001001)
Taxonomy by NCBI:
Arabidopsis thaliana Arabidopsis Brassicaceae Brassicales malvids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA AAGCTCAGGAGGGATAGCGCC miRNA* CGCTATCCATCCTGAGTTCCA mismatches: 2 bulges: 0 |
pre-miRNA
GAGAAATAGCTATAAAGCTCAGGAGGGATAGCGCCATGGCTCACCAGTGCTGTATGTTTTGTATATGCGTACATGTATATCTGTTGGCGCTATCCATCCT
GAGTTCCATAGCTTCTTCTT
dot-bracket secondary structure
(((((..((((((..(((((((((.(((((((((((.((....)).(((((((((((.........))))))).))))......))))))))))).))))
)))))..))))))..)))))
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
degradome data
download this record
evidence: cloned, 454, MPSS, Solexa
deep sequencing data evidence
references
[1] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[2] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[3] Gustafson AM, Allen E, Givan S, Smith D, Carrington JC, Kasschau KD, Nucleic Acids Res. 33:D637-D640(2005)., "ASRP: the Arabidopsis Small RNA Project Database"
[4] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[5] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
[6] Adai A, Johnson C, Mlotshwa S, Archer-Evans S, Manocha V, Vance V, Sundaresan V, Genome Res. 15:78-91(2005)., "Computational prediction of miRNAs in Arabidopsis thaliana"
GAGAAATAGCTATAAAGCTCAGGAGGGATAGCGCCATGGCTCACCAGTGCTGTATGTTTTGTATATGCGTACATGTATATCTGTTGGCGCTATCCATCCT
GAGTTCCATAGCTTCTTCTT
dot-bracket secondary structure
(((((..((((((..(((((((((.(((((((((((.((....)).(((((((((((.........))))))).))))......))))))))))).))))
)))))..))))))..)))))
SIMILARITIES| miRBase aly-MIR390b: 1e-40 PMRD ath-miR390b: 8e-64 microPC miR390: 0.0000001 | UniProt no hits RFAM MIR390: 1e-62 |
Identical with: ath-miR390b from PMRD (MNEST046996) |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
degradome data
download this record
evidence: cloned, 454, MPSS, Solexa
deep sequencing data evidence
references
[1] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[2] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[3] Gustafson AM, Allen E, Givan S, Smith D, Carrington JC, Kasschau KD, Nucleic Acids Res. 33:D637-D640(2005)., "ASRP: the Arabidopsis Small RNA Project Database"
[4] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[5] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
[6] Adai A, Johnson C, Mlotshwa S, Archer-Evans S, Manocha V, Vance V, Sundaresan V, Genome Res. 15:78-91(2005)., "Computational prediction of miRNAs in Arabidopsis thaliana"
