ABOUT THIS RECORDspecies: Arabidopsis thaliana
miRNA family: MIR395
source: miRBase, original name: ath-MIR395c (MI0001009)
Taxonomy by NCBI:
Arabidopsis thaliana Arabidopsis Brassicaceae Brassicales malvids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA CTGAAGTGTTTGGGGGGACTC miRNA* GTTCCCTTTAACGCTTCATTG mismatches: 3 bulges: 0 |
pre-miRNA
ATGTCCACATGAGTTCCCTTTAACGCTTCATTGTTGAATACTCAAAGCCACATTGGTTTGTATATAACACTGAAGTGTTTGGGGGGACTCTTGGTGTCAT
dot-bracket secondary structure
(((..(((..(((((((((..(((((((((.(((((.((((...(((((.....))))))))).))))).)))))))))..)))))))))...))).)))
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
degradome data
download this record
evidence: 5'RACE, Northern, PCR, MPSS
deep sequencing data evidence
references
[1] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[2] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[3] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[4] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
[5] Jones-Rhoades MW, Bartel DP, Mol Cell. 14:787-799(2004)., "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
ATGTCCACATGAGTTCCCTTTAACGCTTCATTGTTGAATACTCAAAGCCACATTGGTTTGTATATAACACTGAAGTGTTTGGGGGGACTCTTGGTGTCAT
dot-bracket secondary structure
(((..(((..(((((((((..(((((((((.(((((.((((...(((((.....))))))))).))))).)))))))))..)))))))))...))).)))
SIMILARITIES| miRBase ath-MIR395b: 8e-45 PMRD ath-miR395c: 5e-52 microPC miR395: 0.0003 | UniProt no hits RFAM mir-395: 9e-51 |
Identical with: ath-miR395c from PMRD (MNEST047004) |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
degradome data
download this record
evidence: 5'RACE, Northern, PCR, MPSS
deep sequencing data evidence
references
[1] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[2] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[3] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[4] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
[5] Jones-Rhoades MW, Bartel DP, Mol Cell. 14:787-799(2004)., "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
