Parental gene:

Sumo2, ENSMUSG00000020738

Aliases:Sumo2, SUMO-2, Smt3A, Smt3b, Smt3h2
Description:SMT3 suppressor of mif two 3 homolog 2 (yeast) [Source:MGI Symbol;Acc:MGI:2158813]
Organism:Mouse (Mus musculus)
Coordinates:11:115523101..115536276(-)


>ENSMUSG00000020738
ATGGCCGACGAGAAACCCAAGGAAGGAGTCAAGACTGAGAACAACGATCATATTAATTTGAAGGTGGCGGGACAGGATGG
TTCTGTGGTGCAGTTTAAGATTAAGAGGCATACACCACTTAGTAAACTAATGAAAGCCTATTGTGAACGGCAGGGTTTGT
CAATGAGGCAGATCAGATTCCGGTTTGATGGGCAGCCAATCAACGAAACAGACACACCTGCACAGTTGGAAATGGAGGAT
GAAGATACGATTGATGTGTTCCAGCAGCAGACTGGAGGTGTCTACTAA

Library Parental gene expression (RPM)
SRP007412_brain 1 .00 RPM
SRP007412_cerebellum 0 .78 RPM
SRP007412_heart 0 .72 RPM
SRP007412_kidney 0 .87 RPM
SRP007412_liver 0 .25 RPM
SRP007412_testis 1 .92 RPM



Species Parental gene accession Homology type Retrogenes number
Canis familiaris ENSCAFG00000004724 ortholog_one2one 1 retrogene
Homo sapiens ENSG00000188612 possible_ortholog 2 retrogenes
Gorilla gorilla ENSGGOG00000023769 ortholog_one2one 3 retrogenes
Loxodonta africana ENSLAFG00000025811 ortholog_one2one 10 retrogenes
Monodelphis domestica ENSMODG00000007222 possible_ortholog 11 retrogenes
Mus musculus ENSMUSG00000020265 within_species_paralog 1 retrogene
Mus musculus ENSMUSG00000026021 within_species_paralog 5 retrogenes
Oryctolagus cuniculus ENSOCUG00000028195 possible_ortholog 5 retrogenes
Pongo abelii ENSPPYG00000029777 possible_ortholog 2 retrogenes

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_mmus_415 100.00 100.00
Please wait, loading
Please wait, loading
Please wait, loading
2. retro_mmus_611 98.91 96.84
Please wait, loading
Please wait, loading
Please wait, loading
3. retro_mmus_689 92.63 100.00
Please wait, loading
Please wait, loading
Please wait, loading
4. retro_mmus_818 96.84 100.00
Please wait, loading
Please wait, loading
Please wait, loading
5. retro_mmus_827 84.21 100.00
Please wait, loading
Please wait, loading
Please wait, loading
6. retro_mmus_1498 100.00 100.00
Please wait, loading
Please wait, loading
Please wait, loading
7. retro_mmus_1772 92.63 100.00
Please wait, loading
Please wait, loading
Please wait, loading
8. retro_mmus_1903 92.63 100.00
Please wait, loading
Please wait, loading
Please wait, loading
9. retro_mmus_2050 100.00 100.00
Please wait, loading
Please wait, loading
Please wait, loading
10. retro_mmus_2323 86.32 100.00
Please wait, loading
Please wait, loading
Please wait, loading
11. retro_mmus_2475 65.59 95.79
Please wait, loading
Please wait, loading
Please wait, loading
12. retro_mmus_2492 82.61 95.79
Please wait, loading
Please wait, loading
Please wait, loading
13. retro_mmus_2590 51.14 90.53
Please wait, loading
Please wait, loading
Please wait, loading
14. retro_mmus_2767 63.54 100.00
Please wait, loading
Please wait, loading
Please wait, loading
15. retro_mmus_2917 95.24 88.42
Please wait, loading
Please wait, loading
Please wait, loading
16. retro_mmus_2974 92.63 100.00
Please wait, loading
Please wait, loading
Please wait, loading
17. retro_mmus_3209 76.84 100.00
Please wait, loading
Please wait, loading
Please wait, loading
18. retro_mmus_3414 92.63 100.00
Please wait, loading
Please wait, loading
Please wait, loading
19. retro_mmus_3630 51.06 96.84
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all ENSMUSG00000020738 retrocopies