ABOUT THIS RECORDspecies: Homo sapiens
miRNA family: mir-125
source: miRBase, original name: hsa-mir-125b-1 (MI0000446)
Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TCCCTGAGACCCTAACTTGTGA miRNA* ACGGGTTAGGCTCTTGGGAGCT mismatches: 6 bulges: 0 |
pre-miRNA
TGCGCTCCTCTCAGTCCCTGAGACCCTAACTTGTGATGTTTACCGTTTAAATCCACGGGTTAGGCTCTTGGGAGCTGCGAGTCGTGCT
dot-bracket secondary structure
.((((..(((.(((..((..(((.(((((((((((..(((((.....))))).))))))))))).)))..))..))).)))..)))).
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Solexa
deep sequencing data evidence
references
[1] Lee YS, Kim HK, Chung S, Kim KS, Dutta A, J Biol Chem. 280:16635-16641(2005)., "Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation"
[2] Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X, FEBS Lett. 579:3849-3854(2005)., "Identification of human fetal liver miRNAs by a novel method"
[3] Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR, Proc Natl Acad Sci U S A. 102:5570-5575(2005)., "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
[4] Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V, BMC Genomics. 11 Suppl 1:S6(2010)., "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha"
[5] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[6] Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
[7] Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T, Curr Biol. 12:735-739(2002)., "Identification of tissue-specific microRNAs from mouse"
TGCGCTCCTCTCAGTCCCTGAGACCCTAACTTGTGATGTTTACCGTTTAAATCCACGGGTTAGGCTCTTGGGAGCTGCGAGTCGTGCT
dot-bracket secondary structure
.((((..(((.(((..((..(((.(((((((((((..(((((.....))))).))))))))))).)))..))..))).)))..)))).
SIMILARITIES| miRBase age-mir-125b-1: 7e-45 PMRD no hits microPC no hits | UniProt no hits RFAM lin-4: 1e-28 |
Identical with: sla-mir-125b from miRBase (MNEST027615) |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Solexa
deep sequencing data evidence
references
[1] Lee YS, Kim HK, Chung S, Kim KS, Dutta A, J Biol Chem. 280:16635-16641(2005)., "Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation"
[2] Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X, FEBS Lett. 579:3849-3854(2005)., "Identification of human fetal liver miRNAs by a novel method"
[3] Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR, Proc Natl Acad Sci U S A. 102:5570-5575(2005)., "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
[4] Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V, BMC Genomics. 11 Suppl 1:S6(2010)., "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha"
[5] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[6] Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
[7] Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T, Curr Biol. 12:735-739(2002)., "Identification of tissue-specific microRNAs from mouse"
