ABOUT THIS RECORDspecies: Drosophila melanogaster
miRNA family: mir-14
source: miRBase, original name: dme-mir-14 (MI0000136)
Taxonomy by NCBI:
Drosophila melanogaster melanogaster subgroup melanogaster group Sophophora Drosophila Drosophiliti Drosophilina Drosophilini Drosophilinae Drosophilidae Ephydroidea Acalyptratae Schizophora Cyclorrhapha Eremoneura Muscomorpha Brachycera Diptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA GGGAGCGAGACGGGGACTCACT miRNA* TCAGTCTTTTTCTCTCTCCTAT mismatches: 4 bulges: 0 |
pre-miRNA
TGTGGGAGCGAGACGGGGACTCACTGTGCTTATTAAATAGTCAGTCTTTTTCTCTCTCCTATA
dot-bracket secondary structure
((((((((.((((..((((((.(((((.........))))).))))))..)))).))))))))
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
references
[1] Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T, Dev Cell. 5:337-350(2003)., "The small RNA profile during Drosophila melanogaster development"
[2] Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V, Dev Biol. 259:9-18(2003)., "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity"
[3] Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
[4] Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
[5] Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T, Science. 294:853-858(2001)., "Identification of novel genes coding for small expressed RNAs"
[6] Xu P, Vernooy SY, Guo M, Hay BA, Curr Biol. 13:790-795(2003)., "The Drosophila microRNA Mir-14 suppresses cell death and is required for normal fat metabolism"
TGTGGGAGCGAGACGGGGACTCACTGTGCTTATTAAATAGTCAGTCTTTTTCTCTCTCCTATA
dot-bracket secondary structure
((((((((.((((..((((((.(((((.........))))).))))))..)))).))))))))
SIMILARITIES| miRBase dan-mir-14: 4e-30 PMRD no hits microPC no hits | UniProt no hits RFAM mir-14: 9e-22 |
Identical with: der-mir-14 from miRBase (MNEST036175) |
MOREmiRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
references
[1] Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T, Dev Cell. 5:337-350(2003)., "The small RNA profile during Drosophila melanogaster development"
[2] Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V, Dev Biol. 259:9-18(2003)., "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity"
[3] Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
[4] Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
[5] Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T, Science. 294:853-858(2001)., "Identification of novel genes coding for small expressed RNAs"
[6] Xu P, Vernooy SY, Guo M, Hay BA, Curr Biol. 13:790-795(2003)., "The Drosophila microRNA Mir-14 suppresses cell death and is required for normal fat metabolism"
