miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Caenorhabditis elegans, Caenorhabditis japonica, Caenorhabditis brenneri, Caenorhabditis remanei



ABOUT THIS RECORD

ID: MNEST038283
species: Caenorhabditis elegans
miRNA family: mir-46
source: miRBase, original name: cel-mir-46 (MI0000017)

Taxonomy by NCBI:
Caenorhabditis elegans Caenorhabditis Peloderinae Rhabditidae Rhabditoidea Rhabditida Chromadorea Nematoda Pseudocoelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TGTCATGGAGTCGCTCTCTTCA

miRNA*
AAGAGAGCCGTCTATTGACAGT

mismatches: 2
bulges: 2

View larger
pre-miRNA
CTGAGGTGAAGCTGAAGAGAGCCGTCTATTGACAGTTCAAGACCACGAGTCGTTGTGTGCTGTCATGGAGTCGCTCTCTTCAGATGATCCGGTCAAT

dot-bracket secondary structure
....((.....(((((((((((..(((((.((((((.((((((.....))).)))...)))))))))))...))))))))))).....)).......


SIMILARITIES
miRBase cbr-mir-46: 0.000000000001

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-46: 1e-37

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Northern, Solexa
deep sequencing data evidence

references

[1] Warf MB, Johnson WE, Bass BL, RNA. 17:563-577(2011)., "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer"
[2] Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D, Curr Biol. 13:807-818(2003)., "MicroRNAs and other tiny endogenous RNAs in C. elegans"
[3] Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP, Genes Dev. 17:991-1008(2003)., "The microRNAs of Caenorhabditis elegans"
[4] Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP, Cell. 127:1193-1207(2006)., "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
[5] Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
[6] Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"
[7] Lau NC, Lim LP, Weinstein EG, Bartel DP, Science. 294:858-862(2001)., "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"




Liczniki na strone;