Parental gene: | LAMTOR3, ENSDNOG00000025421 |
| Aliases: | None |
| Description: | late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 [Source:HGNC Symbol;Acc:15606] |
| Organism: | Armadillo (Dasypus novemcinctus) |
| Coordinates: | GeneScaffold_535:144377..158835(-) |
>ENSDNOG00000025421
GCAAATGATAATGCCCCAGAGCATGCTTTGAGACCTGGTTTCTTATCTACTTTTGCCCTTGCAACAGACCAAGGGAGCAA
ACTTGGACTTTCAAAAAACAAAAGTATTATCTGTTACTATAACACCTACCAGNNNNTTCAATTTAATCGTTTACCTTTGG
TGGTGAGTTCCATAGCCAGCAGCAATGCCAACACAGGACTAATTGTCAGCCTAGAAAAGGAACTTGCTCCGTTGTTTGAA
GAATTGAGACAAGTTGTGGAAGTTTCTTAA
| Library | Parental gene expression (RPM) |
|---|---|
| SRP012922_ascending_colon | 1 .17 RPM |
| SRP012922_cerebellum | 0 .96 RPM |
| SRP012922_heart | 0 .46 RPM |
| SRP012922_kidney | 1 .10 RPM |
| SRP012922_liver | 0 .31 RPM |
| SRP012922_lung | 1 .07 RPM |
| SRP012922_quadricep_muscle | 0 .35 RPM |
| SRP012922_spleen | 1 .37 RPM |
| Species | Parental gene accession | Homology type | Retrogenes number | |
|---|---|---|---|---|
| Ailuropoda melanoleuca | ENSAMEG00000000995 | ortholog_one2one | 4 retrogenes | |
| Choloepus hoffmanni | ENSCHOG00000013153 | ortholog_one2one | 7 retrogenes | |
| Callithrix jacchus | ENSCJAG00000015196 | ortholog_one2one | 4 retrogenes | |
| Cavia porcellus | ENSCPOG00000013304 | ortholog_one2one | 2 retrogenes | |
| Dipodomys ordii | ENSDORG00000015501 | ortholog_one2one | 5 retrogenes | |
| Equus caballus | ENSECAG00000013569 | ortholog_one2one | 1 retrogene | |
| Homo sapiens | ENSG00000109270 | ortholog_one2one | 2 retrogenes | |
| Gorilla gorilla | ENSGGOG00000001132 | ortholog_one2one | 2 retrogenes | |
| Loxodonta africana | ENSLAFG00000015740 | ortholog_one2one | 1 retrogene | |
| Myotis lucifugus | ENSMLUG00000006786 | ortholog_one2one | 2 retrogenes | |
| Macaca mulatta | ENSMMUG00000006830 | ortholog_one2one | 1 retrogene | |
| Monodelphis domestica | ENSMODG00000020688 | ortholog_one2one | 3 retrogenes | |
| Mus musculus | ENSMUSG00000091512 | possible_ortholog | 1 retrogene | |
| Nomascus leucogenys | ENSNLEG00000013684 | ortholog_one2one | 2 retrogenes | |
| Pongo abelii | ENSPPYG00000014955 | ortholog_one2one | 3 retrogenes | |
| Pan troglodytes | ENSPTRG00000016310 | ortholog_one2one | 1 retrogene | |
| Pteropus vampyrus | ENSPVAG00000017674 | ortholog_one2one | 1 retrogene |
| # | RetrogeneDB ID | Identity (%) | Coverage (%) | ORF conservation | Expression evidence | RDV |
|---|---|---|---|---|---|---|
| 1. | retro_dnov_118 | 72.29 | 92.13 | Please wait, loading  |
Please wait, loading |
Please wait, loading |
| 2. | retro_dnov_137 | 82.02 | 98.88 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 3. | retro_dnov_487 | 96.63 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 4. | retro_dnov_522 | 79.35 | 97.75 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 5. | retro_dnov_626 | 88.76 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 6. | retro_dnov_938 | 84.44 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 7. | retro_dnov_939 | 72.53 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 8. | retro_dnov_1057 | 73.33 | 67.42 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 9. | retro_dnov_1190 | 94.32 | 98.88 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 10. | retro_dnov_1332 | 73.33 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 11. | retro_dnov_2003 | 82.02 | 98.88 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 12. | retro_dnov_2213 | 72.84 | 86.52 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 13. | retro_dnov_2597 | 74.44 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 14. | retro_dnov_2665 | 80.90 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
Download FASTA sequences of all ENSDNOG00000025421 retrocopies