RetrogeneDB ID:

retro_hsap_757

Retrocopy
location
Organism:Human (Homo sapiens)
Coordinates:11:18686792..18687095(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:ENSG00000257043
Aliases:None
Status:KNOWN_PSEUDOGENE
Parental gene
information
Parental gene summary:
Parental gene symbol:SRSF3
Ensembl ID:ENSG00000112081
Aliases:None
Description:serine/arginine-rich splicing factor 3 [Source:HGNC Symbol;Acc:10785]


Retrocopy-Parental alignment summary:






>retro_hsap_757
CGAGAGCTAAATGGAAGAACACTATGTGGCTGCTGTGTAAGAGTGGAACTGTCCAATGGTGAAAAAAGAAGTAGAAATCA
TGGCCCACCTCCCTCCTGGGGTCGTCGCCCTCAAGATGATTATCGTAGGAGTAGTCCTCCACCTCGTCGCAGATCTCCAA
GAAGGAGAAGCTTCTCTCACAGCTGGAGCAGGTCCCTTTCTAGAGATGGGAGAAGAGAGAGGTCGCTGTCTCGGGAGAGA
AATCACAAGCCGTCCCGATCCTTCTCTAGGTCTCGTAGCCGATCTAGGTCAAATGAAAGGAAA

ORF - retro_hsap_757 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 92.08 %
Parental protein coverage: 61.59 %
Number of stop codons detected: 0
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalRELDGRTLCGCRVRVELSNGEKRSRNRGPPPSWGRRPRDDYRRRSPPPRRRSPRRRSFSRSRSRSLSRDR
REL.GRTLCGC.VRVELSNGEKRSRN.GPPPSWGRRP.DDYRR.SPPPRRRSPRRRSFS.S.SRSLSRD.
RetrocopyRELNGRTLCGCCVRVELSNGEKRSRNHGPPPSWGRRPQDDYRRSSPPPRRRSPRRRSFSHSWSRSLSRDG
ParentalRRERSLSRERNHKPSRSFSRSRSRSRSNERK
RRERSLSRERNHKPSRSFSRSRSRSRSNERK
RetrocopyRRERSLSRERNHKPSRSFSRSRSRSRSNERK

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
bodymap2_adipose 0 .12 RPM 208 .98 RPM
bodymap2_adrenal 0 .02 RPM 309 .56 RPM
bodymap2_brain 0 .05 RPM 159 .23 RPM
bodymap2_breast 0 .02 RPM 213 .85 RPM
bodymap2_colon 0 .31 RPM 155 .50 RPM
bodymap2_heart 0 .00 RPM 112 .87 RPM
bodymap2_kidney 0 .06 RPM 220 .70 RPM
bodymap2_liver 0 .00 RPM 99 .66 RPM
bodymap2_lung 0 .00 RPM 176 .71 RPM
bodymap2_lymph_node 0 .00 RPM 286 .09 RPM
bodymap2_ovary 0 .21 RPM 433 .11 RPM
bodymap2_prostate 0 .03 RPM 401 .19 RPM
bodymap2_skeletal_muscle 0 .00 RPM 74 .72 RPM
bodymap2_testis 0 .02 RPM 270 .24 RPM
bodymap2_thyroid 0 .00 RPM 318 .10 RPM
bodymap2_white_blood_cells 0 .00 RPM 253 .48 RPM
RNA Polymerase II actvity near the 5' end of retro_hsap_757 was not detected
No EST(s) were mapped for retro_hsap_757 retrocopy.
No TSS is located nearby retro_hsap_757 retrocopy 5' end.
retro_hsap_757 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_hsap_757 has 2 orthologous retrocopies within eutheria group .

Species RetrogeneDB ID
Pan troglodytes retro_ptro_533
Gorilla gorilla retro_ggor_630

Parental genes homology:
Parental genes homology involve 18 parental genes, and 80 retrocopies.

Species Parental gene accession Retrocopies number
Bos taurus ENSBTAG000000400065 retrocopies
Callithrix jacchus ENSCJAG000000160625 retrocopies
Homo sapiens ENSG000001117861 retrocopy
Homo sapiens ENSG00000112081 4 retrocopies
Homo sapiens ENSG000001241931 retrocopy
Loxodonta africana ENSLAFG000000181932 retrocopies
Microcebus murinus ENSMICG000000046745 retrocopies
Myotis lucifugus ENSMLUG000000106716 retrocopies
Mustela putorius furoENSMPUG000000142151 retrocopy
Mus musculus ENSMUSG000000711729 retrocopies
Otolemur garnettii ENSOGAG000000005026 retrocopies
Ochotona princeps ENSOPRG000000060063 retrocopies
Rattus norvegicus ENSRNOG0000000052011 retrocopies
Sus scrofa ENSSSCG000000015641 retrocopy
Ictidomys tridecemlineatus ENSSTOG000000142805 retrocopies
Tarsius syrichta ENSTSYG000000134983 retrocopies
Tursiops truncatus ENSTTRG0000001344711 retrocopies
Vicugna pacos ENSVPAG000000054811 retrocopy

Expression level across human populations :
image/svg+xml GBR_HG00142 GBR_HG00099 GBR_HG00114 GBR_HG00143 GBR_HG00131 GBR_HG00137 GBR_HG00133 GBR_HG00119 GBR_HG00111 GBR_HG00134 FIN_HG00378 FIN_HG00338 FIN_HG00349 FIN_HG00375 FIN_HG00315 FIN_HG00277 FIN_HG00328 FIN_HG00321 FIN_HG00377 FIN_HG00183 TSI_NA20756 TSI_NA20538 TSI_NA20798 TSI_NA20532 TSI_NA20765 TSI_NA20518 TSI_NA20513 TSI_NA20512 TSI_NA20771 TSI_NA20786 YRI_NA19114 YRI_NA19099 YRI_NA18870 YRI_NA18907 YRI_NA19223 YRI_NA19214 YRI_NA18916 YRI_NA19093 YRI_NA19118 YRI_NA19213 Toscaniin Italia: Finnish inFinland: British in England and Scotland: Utah Residents (CEPH) with Northernand Western European Ancestry: Yoruba in Ibadan, Nigeria: CEU_NA12760 CEU_NA12827 CEU_NA12872 CEU_NA12751 CEU_NA12873 CEU_NA12400 CEU_NA11930 CEU_NA12004 CEU_NA11831 CEU_NA11843 No expression ( = 0 RPM ) > 0 RPM = 0.16 RPM Legend:


Library Retrogene expression
CEU_NA11831 0 .02 RPM
CEU_NA11843 0 .03 RPM
CEU_NA11930 0 .03 RPM
CEU_NA12004 0 .00 RPM
CEU_NA12400 0 .00 RPM
CEU_NA12751 0 .07 RPM
CEU_NA12760 0 .00 RPM
CEU_NA12827 0 .00 RPM
CEU_NA12872 0 .00 RPM
CEU_NA12873 0 .03 RPM
FIN_HG00183 0 .03 RPM
FIN_HG00277 0 .07 RPM
FIN_HG00315 0 .00 RPM
FIN_HG00321 0 .00 RPM
FIN_HG00328 0 .02 RPM
FIN_HG00338 0 .04 RPM
FIN_HG00349 0 .06 RPM
FIN_HG00375 0 .00 RPM
FIN_HG00377 0 .00 RPM
FIN_HG00378 0 .04 RPM
GBR_HG00099 0 .00 RPM
GBR_HG00111 0 .00 RPM
GBR_HG00114 0 .00 RPM
GBR_HG00119 0 .00 RPM
GBR_HG00131 0 .03 RPM
GBR_HG00133 0 .07 RPM
GBR_HG00134 0 .00 RPM
GBR_HG00137 0 .03 RPM
GBR_HG00142 0 .00 RPM
GBR_HG00143 0 .06 RPM
TSI_NA20512 0 .06 RPM
TSI_NA20513 0 .05 RPM
TSI_NA20518 0 .00 RPM
TSI_NA20532 0 .03 RPM
TSI_NA20538 0 .00 RPM
TSI_NA20756 0 .06 RPM
TSI_NA20765 0 .04 RPM
TSI_NA20771 0 .00 RPM
TSI_NA20786 0 .03 RPM
TSI_NA20798 0 .06 RPM
YRI_NA18870 0 .03 RPM
YRI_NA18907 0 .00 RPM
YRI_NA18916 0 .00 RPM
YRI_NA19093 0 .00 RPM
YRI_NA19099 0 .16 RPM
YRI_NA19114 0 .00 RPM
YRI_NA19118 0 .02 RPM
YRI_NA19213 0 .02 RPM
YRI_NA19214 0 .05 RPM
YRI_NA19223 0 .02 RPM


Indel association:

No indels were associated with its genomic coordinates. Based on Kabza et al. 2015 (PubMed).




Copyright © RetrogeneDB 2014-2017