RetrogeneDB ID:

retro_lcha_71

Retrocopy
location
Organism:Coelacanth (Latimeria chalumnae)
Coordinates:JH127198.1:466521..466786(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:RPL37A
Ensembl ID:ENSLACG00000011578
Aliases:None
Description:None


Retrocopy-Parental alignment summary:






>retro_lcha_71
TCAAGAAAGTTGGGATTTATAGGTAAATACAGGACCCGTCACGGTGCCTCCCTCAGGAAAATGGTTAAGAACACTGAAAT
TAGTCTTGATGCCGATTACACAATGCTTGTTCTGTGGTGAGACCTAGACGAAGAGCAGGGCTGGAGGGATCTGGTAATGT
GGATCCTGCAGGGAGACCGTTGTGGCTGGTGCCTGGGCTTCCACTGCCACCTCTGCTGTCTCTGTGAGATTTGCAGTCCG
AAGACGGAAGCAATTGAAAGACCAG

ORF - retro_lcha_71 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 64.04 %
Parental protein coverage: 95.65 %
Number of stop codons detected: 2
Number of frameshifts detected: 1


Retrocopy - Parental Gene Alignment:

ParentalTKKVGIVGKYGTRYGASLRKMVKKIEISQHAKYT-CSFCGKTKMKRRAVGIWHCGSCRKTVAGGAWTYNT
..K.G..GKY.TR.GASLRKMVK..EIS..A.YT.C.FCG.T..K.RA.GIW.CGSCR.TV..GAW....
RetrocopySRKLGFIGKYRTRHGASLRKMVKNTEISLDADYT>CLFCGET*TKSRAGGIW*CGSCRETVVAGAWASTA
ParentalTSAVTVRSAIRRLKELKDQ
TSAV.VR.A.RR.K.LKDQ
RetrocopyTSAVSVRFAVRRRKQLKDQ

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
DRP000627_gill 0 .00 RPM 920 .84 RPM
DRP000627_kidney 0 .00 RPM 863 .63 RPM
DRP000627_pectoral_fin 0 .06 RPM 1383 .50 RPM
DRP000627_pelvic_fin 0 .00 RPM 1472 .51 RPM
DRP000627_pharynx 0 .00 RPM 594 .65 RPM
DRP000627_tail_muscle 0 .00 RPM 454 .17 RPM
Latimeria chalumnae was not studied using ChIP-Seq data.
Latimeria chalumnae was not studied using EST data.
Latimeria chalumnae was not studied using FANTOM5 data.
retro_lcha_71 was not experimentally validated.

Retrocopy orthology:
Latimeria chalumnae does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 28 parental genes, and 374 retrocopies.

Species Parental gene accession Retrocopies number
Ailuropoda melanoleuca ENSAMEG0000000337724 retrocopies
Bos taurus ENSBTAG000000038469 retrocopies
Choloepus hoffmanni ENSCHOG0000000400014 retrocopies
Callithrix jacchus ENSCJAG000000124177 retrocopies
Equus caballus ENSECAG000000120466 retrocopies
Echinops telfairi ENSETEG0000001435234 retrocopies
Felis catus ENSFCAG0000002701021 retrocopies
Homo sapiens ENSG000001977566 retrocopies
Gorilla gorilla ENSGGOG000000148275 retrocopies
Latimeria chalumnae ENSLACG00000011578 1 retrocopy
retro_lcha_71 ,
Loxodonta africana ENSLAFG000000068495 retrocopies
Macropus eugenii ENSMEUG0000000468023 retrocopies
Myotis lucifugus ENSMLUG000000007621 retrocopy
Macaca mulatta ENSMMUG0000001954411 retrocopies
Monodelphis domestica ENSMODG000000254859 retrocopies
Mus musculus ENSMUSG0000004633018 retrocopies
Nomascus leucogenys ENSNLEG000000072768 retrocopies
Otolemur garnettii ENSOGAG000000008173 retrocopies
Ochotona princeps ENSOPRG0000000443610 retrocopies
Procavia capensis ENSPCAG000000068915 retrocopies
Petromyzon marinus ENSPMAG000000000011 retrocopy
Pongo abelii ENSPPYG000000258781 retrocopy
Pan troglodytes ENSPTRG000000290296 retrocopies
Pteropus vampyrus ENSPVAG0000000610212 retrocopies
Sarcophilus harrisii ENSSHAG0000001341710 retrocopies
Tupaia belangeri ENSTBEG00000007409108 retrocopies
retro_tbel_1089, retro_tbel_1095, retro_tbel_1113, retro_tbel_1168, retro_tbel_1198, retro_tbel_1204, retro_tbel_1218, retro_tbel_1244, retro_tbel_1345, retro_tbel_1352, retro_tbel_141, retro_tbel_1434, retro_tbel_1466, retro_tbel_1471, retro_tbel_148, retro_tbel_1489, retro_tbel_1502, retro_tbel_151, retro_tbel_1534, retro_tbel_1683, retro_tbel_1714, retro_tbel_1807, retro_tbel_1835, retro_tbel_1838, retro_tbel_1922, retro_tbel_194, retro_tbel_1973, retro_tbel_1992, retro_tbel_1995, retro_tbel_2002, retro_tbel_2044, retro_tbel_2083, retro_tbel_209, retro_tbel_2101, retro_tbel_2178, retro_tbel_2190, retro_tbel_223, retro_tbel_2381, retro_tbel_2631, retro_tbel_2699, retro_tbel_2705, retro_tbel_2725, retro_tbel_2780, retro_tbel_2813, retro_tbel_2844, retro_tbel_285, retro_tbel_286, retro_tbel_2985, retro_tbel_3022, retro_tbel_3048, retro_tbel_3108, retro_tbel_3118, retro_tbel_3211, retro_tbel_3490, retro_tbel_350, retro_tbel_3565, retro_tbel_3593, retro_tbel_3632, retro_tbel_3641, retro_tbel_3651, retro_tbel_3757, retro_tbel_3784, retro_tbel_3837, retro_tbel_3901, retro_tbel_3910, retro_tbel_3912, retro_tbel_3916, retro_tbel_3919, retro_tbel_3955, retro_tbel_3969, retro_tbel_3970, retro_tbel_4055, retro_tbel_4098, retro_tbel_4099, retro_tbel_4117, retro_tbel_412, retro_tbel_4148, retro_tbel_4188, retro_tbel_420, retro_tbel_4244, retro_tbel_4382, retro_tbel_4452, retro_tbel_4522, retro_tbel_4524, retro_tbel_458, retro_tbel_4586, retro_tbel_4588, retro_tbel_4613, retro_tbel_4703, retro_tbel_472, retro_tbel_500, retro_tbel_566, retro_tbel_574, retro_tbel_583, retro_tbel_590, retro_tbel_594, retro_tbel_595, retro_tbel_622, retro_tbel_648, retro_tbel_681, retro_tbel_739, retro_tbel_767, retro_tbel_790, retro_tbel_834, retro_tbel_870, retro_tbel_893, retro_tbel_907, retro_tbel_998,
Tarsius syrichta ENSTSYG0000000425811 retrocopies
Vicugna pacos ENSVPAG000000025295 retrocopies



Copyright © RetrogeneDB 2014-2017