RetrogeneDB ID:

retro_fcat_1662

Retrocopy
location
Organism:Cat (Felis catus)
Coordinates:E1:14958011..14958192(-)
Located in intron of:None
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:RPL37A
Ensembl ID:ENSFCAG00000027010
Aliases:None
Description:ribosomal protein L37a [Source:HGNC Symbol;Acc:10348]


Retrocopy-Parental alignment summary:






>retro_fcat_1662
AGCCAGCACACAAGTACACTTCCTCCTTGTGTGGAAAACCAAGATGAAAAATGAGCTGTGGGGATCTGGCATTGTGGTTC
CTGCATGCAAACCATAGCGAGCAGGTGGTGCCTGGAACTACAACACCACGTCTGCTGTCACAGCAAAGTCAGTCATGAGA
AGACTGAAGGAGTTGAAAGAA

ORF - retro_fcat_1662 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 59.09 %
Parental protein coverage: 65.22 %
Number of stop codons detected: 1
Number of frameshifts detected: 2


Retrocopy - Parental Gene Alignment:

ParentalSQHA-KYTCSFCGK-TKMKRRAVGIWHCG----SCMKTVAGGAWTYNTTSAVTVKSAIRRLKELKD
SQH..KYT.S.CGK.TKMK......W..G.....C....AGGAW.YNTTSAVT.KS..RRLKELK.
RetrocopySQHT<KYTSSLCGK<TKMKNE---LWGSGIVVPACKP*RAGGAWNYNTTSAVTAKSVMRRLKELKE

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
SRP017611_brain 0 .11 RPM 61 .17 RPM
SRP017611_kidney 0 .21 RPM 219 .82 RPM
SRP017611_liver 0 .00 RPM 103 .31 RPM
Felis catus was not studied using ChIP-Seq data.
No EST(s) were mapped for retro_fcat_1662 retrocopy.
Felis catus was not studied using FANTOM5 data.
retro_fcat_1662 was not experimentally validated.

Retrocopy orthology:
Felis catus does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 17 parental genes, and 243 retrocopies.

Species Parental gene accession Retrocopies number
Bos taurus ENSBTAG000000038469 retrocopies
Choloepus hoffmanni ENSCHOG0000000400014 retrocopies
Felis catus ENSFCAG00000027010 21 retrocopies
Homo sapiens ENSG000001977566 retrocopies
Gorilla gorilla ENSGGOG000000148275 retrocopies
Latimeria chalumnae ENSLACG000000115781 retrocopy
Monodelphis domestica ENSMODG000000254859 retrocopies
Mus musculus ENSMUSG0000004633018 retrocopies
Nomascus leucogenys ENSNLEG000000072768 retrocopies
Ochotona princeps ENSOPRG0000000443610 retrocopies
Petromyzon marinus ENSPMAG000000000011 retrocopy
Pongo abelii ENSPPYG000000258781 retrocopy
Pan troglodytes ENSPTRG000000290296 retrocopies
Sarcophilus harrisii ENSSHAG0000001341710 retrocopies
Tupaia belangeri ENSTBEG00000007409108 retrocopies
retro_tbel_1089, retro_tbel_1095, retro_tbel_1113, retro_tbel_1168, retro_tbel_1198, retro_tbel_1204, retro_tbel_1218, retro_tbel_1244, retro_tbel_1345, retro_tbel_1352, retro_tbel_141, retro_tbel_1434, retro_tbel_1466, retro_tbel_1471, retro_tbel_148, retro_tbel_1489, retro_tbel_1502, retro_tbel_151, retro_tbel_1534, retro_tbel_1683, retro_tbel_1714, retro_tbel_1807, retro_tbel_1835, retro_tbel_1838, retro_tbel_1922, retro_tbel_194, retro_tbel_1973, retro_tbel_1992, retro_tbel_1995, retro_tbel_2002, retro_tbel_2044, retro_tbel_2083, retro_tbel_209, retro_tbel_2101, retro_tbel_2178, retro_tbel_2190, retro_tbel_223, retro_tbel_2381, retro_tbel_2631, retro_tbel_2699, retro_tbel_2705, retro_tbel_2725, retro_tbel_2780, retro_tbel_2813, retro_tbel_2844, retro_tbel_285, retro_tbel_286, retro_tbel_2985, retro_tbel_3022, retro_tbel_3048, retro_tbel_3108, retro_tbel_3118, retro_tbel_3211, retro_tbel_3490, retro_tbel_350, retro_tbel_3565, retro_tbel_3593, retro_tbel_3632, retro_tbel_3641, retro_tbel_3651, retro_tbel_3757, retro_tbel_3784, retro_tbel_3837, retro_tbel_3901, retro_tbel_3910, retro_tbel_3912, retro_tbel_3916, retro_tbel_3919, retro_tbel_3955, retro_tbel_3969, retro_tbel_3970, retro_tbel_4055, retro_tbel_4098, retro_tbel_4099, retro_tbel_4117, retro_tbel_412, retro_tbel_4148, retro_tbel_4188, retro_tbel_420, retro_tbel_4244, retro_tbel_4382, retro_tbel_4452, retro_tbel_4522, retro_tbel_4524, retro_tbel_458, retro_tbel_4586, retro_tbel_4588, retro_tbel_4613, retro_tbel_4703, retro_tbel_472, retro_tbel_500, retro_tbel_566, retro_tbel_574, retro_tbel_583, retro_tbel_590, retro_tbel_594, retro_tbel_595, retro_tbel_622, retro_tbel_648, retro_tbel_681, retro_tbel_739, retro_tbel_767, retro_tbel_790, retro_tbel_834, retro_tbel_870, retro_tbel_893, retro_tbel_907, retro_tbel_998,
Tarsius syrichta ENSTSYG0000000425811 retrocopies
Vicugna pacos ENSVPAG000000025295 retrocopies



Copyright © RetrogeneDB 2014-2017