RetrogeneDB ID:

retro_ggor_2636

Retrocopy
location
Organism:Gorilla (Gorilla gorilla)
Coordinates:7:137524874..137525109(-)
Located in intron of:None
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:RPL37A
Ensembl ID:ENSGGOG00000014827
Aliases:None
Description:None


Retrocopy-Parental alignment summary:






>retro_ggor_2636
CAAGAAGTTGGAATCGTTGGTAAATACAGGACCCGCTATGGGGTCTCCCTCCAGAAAATGGTGAAGAAAATTGAAATCAG
CCAGTACGCCAAGTACATTTGCTCTTTTCTGTGGCAAAACCAAGATGAAGAGATGAGCTGTGGGGCTCTGGCGCTGTGGT
TCCTGCATGAAGACAGTAACGGTGTCTTCATGCAGGAACCACATTGTCTGGACCTGCACTACCACTTCAGCTGTC

ORF - retro_ggor_2636 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 65.82 %
Parental protein coverage: 84.78 %
Number of stop codons detected: 1
Number of frameshifts detected 1


Retrocopy - Parental Gene Alignment:

ParentalKKVGIVGKYGTRYGASLRKMVKKIEISQHAKYTCS-FCGKTKMKRRAVGIWHCGSCMKTVAGGAWTYNTT
..VGIVGKY.TRYG.SL.KMVKKIEISQ.AKY.CS.FCGKTKMKR.AVG.W.CGSCMKTV..........
RetrocopyQEVGIVGKYRTRYGVSLQKMVKKIEISQYAKYICS>FCGKTKMKR*AVGLWRCGSCMKTVTVSSCRNHIV
ParentalSAVTVKSAI
...T..SA.
RetrocopyWTCTTTSAV

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
SRP007412_brain_prefrontal_cortex 0 .00 RPM 158 .06 RPM
SRP007412_cerebellum 0 .00 RPM 165 .87 RPM
SRP007412_heart 0 .00 RPM 136 .09 RPM
SRP007412_kidney 0 .04 RPM 363 .87 RPM
SRP007412_liver 0 .00 RPM 317 .93 RPM
SRP007412_testis 0 .62 RPM 268 .74 RPM
Gorilla gorilla was not studied using ChIP-Seq data.
Gorilla gorilla was not studied using EST data.
Gorilla gorilla was not studied using FANTOM5 data.
retro_ggor_2636 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_ggor_2636 has 0 orthologous retrocopies within eutheria group .


Parental genes homology:
Parental genes homology involve 20 parental genes, and 293 retrocopies.

Species Parental gene accession Retrocopies number
Bos taurus ENSBTAG000000038469 retrocopies
Choloepus hoffmanni ENSCHOG0000000400014 retrocopies
Echinops telfairi ENSETEG0000001435234 retrocopies
Felis catus ENSFCAG0000002701021 retrocopies
Homo sapiens ENSG000001977566 retrocopies
Gorilla gorilla ENSGGOG00000014827 5 retrocopies
Latimeria chalumnae ENSLACG000000115781 retrocopy
Macaca mulatta ENSMMUG0000001954411 retrocopies
Monodelphis domestica ENSMODG000000254859 retrocopies
Mus musculus ENSMUSG0000004633018 retrocopies
Nomascus leucogenys ENSNLEG000000072768 retrocopies
Ochotona princeps ENSOPRG0000000443610 retrocopies
Procavia capensis ENSPCAG000000068915 retrocopies
Petromyzon marinus ENSPMAG000000000011 retrocopy
Pongo abelii ENSPPYG000000258781 retrocopy
Pan troglodytes ENSPTRG000000290296 retrocopies
Sarcophilus harrisii ENSSHAG0000001341710 retrocopies
Tupaia belangeri ENSTBEG00000007409108 retrocopies
retro_tbel_1089, retro_tbel_1095, retro_tbel_1113, retro_tbel_1168, retro_tbel_1198, retro_tbel_1204, retro_tbel_1218, retro_tbel_1244, retro_tbel_1345, retro_tbel_1352, retro_tbel_141, retro_tbel_1434, retro_tbel_1466, retro_tbel_1471, retro_tbel_148, retro_tbel_1489, retro_tbel_1502, retro_tbel_151, retro_tbel_1534, retro_tbel_1683, retro_tbel_1714, retro_tbel_1807, retro_tbel_1835, retro_tbel_1838, retro_tbel_1922, retro_tbel_194, retro_tbel_1973, retro_tbel_1992, retro_tbel_1995, retro_tbel_2002, retro_tbel_2044, retro_tbel_2083, retro_tbel_209, retro_tbel_2101, retro_tbel_2178, retro_tbel_2190, retro_tbel_223, retro_tbel_2381, retro_tbel_2631, retro_tbel_2699, retro_tbel_2705, retro_tbel_2725, retro_tbel_2780, retro_tbel_2813, retro_tbel_2844, retro_tbel_285, retro_tbel_286, retro_tbel_2985, retro_tbel_3022, retro_tbel_3048, retro_tbel_3108, retro_tbel_3118, retro_tbel_3211, retro_tbel_3490, retro_tbel_350, retro_tbel_3565, retro_tbel_3593, retro_tbel_3632, retro_tbel_3641, retro_tbel_3651, retro_tbel_3757, retro_tbel_3784, retro_tbel_3837, retro_tbel_3901, retro_tbel_3910, retro_tbel_3912, retro_tbel_3916, retro_tbel_3919, retro_tbel_3955, retro_tbel_3969, retro_tbel_3970, retro_tbel_4055, retro_tbel_4098, retro_tbel_4099, retro_tbel_4117, retro_tbel_412, retro_tbel_4148, retro_tbel_4188, retro_tbel_420, retro_tbel_4244, retro_tbel_4382, retro_tbel_4452, retro_tbel_4522, retro_tbel_4524, retro_tbel_458, retro_tbel_4586, retro_tbel_4588, retro_tbel_4613, retro_tbel_4703, retro_tbel_472, retro_tbel_500, retro_tbel_566, retro_tbel_574, retro_tbel_583, retro_tbel_590, retro_tbel_594, retro_tbel_595, retro_tbel_622, retro_tbel_648, retro_tbel_681, retro_tbel_739, retro_tbel_767, retro_tbel_790, retro_tbel_834, retro_tbel_870, retro_tbel_893, retro_tbel_907, retro_tbel_998,
Tarsius syrichta ENSTSYG0000000425811 retrocopies
Vicugna pacos ENSVPAG000000025295 retrocopies



Copyright © RetrogeneDB 2014-2017