RetrogeneDB ID:

retro_ggor_1749

Retrocopy
location
Organism:Gorilla (Gorilla gorilla)
Coordinates:2b:113334496..113334751(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:RPS27A
Ensembl ID:ENSGGOG00000007678
Aliases:None
Description:None


Retrocopy-Parental alignment summary:






>retro_ggor_1749
AATGGGCATCCTTTGTCTAACTACAACATTCAAAAGGAGTCTACTCTTCGTCTCATGTTGAGACTTTGTAGTGGCTCTAA
GAAAAGGAAGAAGTCTTACACCCCTCCCAAAAACAATAAGCATAAAACAAAGAAGGTGAAGCTGGCTGTCCTGAAATACT
ACAGGATGGATGACAATGGCAAAAGTAGTAGCCTCCGTCGGGAGTGTCCTTCAGATGGATGTGGTCCTAGAGTTTTTATG
GCCAGCCACTTTGAC

ORF - retro_ggor_1749 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 75.58 %
Parental protein coverage: 55.13 %
Number of stop codons detected: 0
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalDGRTLSDYNIQKESTLHLVLRLRGGAKKRKKKSYTTPKKNKHKRKKVKLAVLKYYKVDENGKISRLRREC
.G..LS.YNIQKESTL.L.LRL..G.KKRKK.SYT.PK.NKHK.KKVKLAVLKYY..D.NGK.S.LRREC
RetrocopyNGHPLSNYNIQKESTLRLMLRLCSGSKKRKK-SYTPPKNNKHKTKKVKLAVLKYYRMDDNGKSSSLRREC
ParentalPSDECGAGVFMASHFD
PSD.CG..VFMASHFD
RetrocopyPSDGCGPRVFMASHFD

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
SRP007412_brain_prefrontal_cortex 0 .00 RPM 105 .69 RPM
SRP007412_cerebellum 0 .00 RPM 133 .52 RPM
SRP007412_heart 0 .00 RPM 62 .04 RPM
SRP007412_kidney 0 .00 RPM 336 .07 RPM
SRP007412_liver 0 .00 RPM 334 .68 RPM
SRP007412_testis 0 .00 RPM 172 .39 RPM
Gorilla gorilla was not studied using ChIP-Seq data.
Gorilla gorilla was not studied using EST data.
Gorilla gorilla was not studied using FANTOM5 data.
retro_ggor_1749 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_ggor_1749 has 1 orthologous retrocopies within eutheria group .

Species RetrogeneDB ID
Homo sapiens retro_hsap_2217

Parental genes homology:
Parental genes homology involve 28 parental genes, and 256 retrocopies.

Species Parental gene accession Retrocopies number
Ailuropoda melanoleuca ENSAMEG000000040175 retrocopies
Bos taurus ENSBTAG000000154736 retrocopies
Canis familiaris ENSCAFG000000234713 retrocopies
Callithrix jacchus ENSCJAG000000100525 retrocopies
Cavia porcellus ENSCPOG000000058197 retrocopies
Dasypus novemcinctus ENSDNOG0000000481312 retrocopies
Dipodomys ordii ENSDORG0000000629111 retrocopies
Equus caballus ENSECAG000000187733 retrocopies
Erinaceus europaeus ENSEEUG000000023299 retrocopies
Felis catus ENSFCAG000000239391 retrocopy
Gorilla gorilla ENSGGOG00000007678 9 retrocopies
Loxodonta africana ENSLAFG000000231332 retrocopies
Macropus eugenii ENSMEUG0000000891713 retrocopies
Myotis lucifugus ENSMLUG0000001706410 retrocopies
Myotis lucifugus ENSMLUG000000294491 retrocopy
Monodelphis domestica ENSMODG000000018193 retrocopies
Mustela putorius furoENSMPUG000000104686 retrocopies
Oryctolagus cuniculus ENSOCUG0000000361310 retrocopies
Ochotona princeps ENSOPRG0000001046913 retrocopies
Pongo abelii ENSPPYG000000258711 retrocopy
Pan troglodytes ENSPTRG000000119281 retrocopy
Pteropus vampyrus ENSPVAG000000164713 retrocopies
Rattus norvegicus ENSRNOG000000044262 retrocopies
Sus scrofa ENSSSCG000000223571 retrocopy
Ictidomys tridecemlineatus ENSSTOG000000095665 retrocopies
Tupaia belangeri ENSTBEG0000000462695 retrocopies
retro_tbel_1019, retro_tbel_1022, retro_tbel_1057, retro_tbel_1058, retro_tbel_106, retro_tbel_1081, retro_tbel_1086, retro_tbel_1090, retro_tbel_1134, retro_tbel_1255, retro_tbel_1385, retro_tbel_1403, retro_tbel_1459, retro_tbel_1493, retro_tbel_1565, retro_tbel_1566, retro_tbel_157, retro_tbel_1584, retro_tbel_1606, retro_tbel_1623, retro_tbel_1673, retro_tbel_1678, retro_tbel_1760, retro_tbel_1825, retro_tbel_1863, retro_tbel_1902, retro_tbel_1946, retro_tbel_1952, retro_tbel_2067, retro_tbel_2119, retro_tbel_2122, retro_tbel_2123, retro_tbel_2238, retro_tbel_2354, retro_tbel_2408, retro_tbel_2605, retro_tbel_2671, retro_tbel_2739, retro_tbel_283, retro_tbel_2913, retro_tbel_2939, retro_tbel_2952, retro_tbel_3056, retro_tbel_3119, retro_tbel_3120, retro_tbel_3125, retro_tbel_3180, retro_tbel_3183, retro_tbel_3213, retro_tbel_3258, retro_tbel_3260, retro_tbel_3283, retro_tbel_3389, retro_tbel_3446, retro_tbel_3480, retro_tbel_3481, retro_tbel_3505, retro_tbel_3576, retro_tbel_3595, retro_tbel_3621, retro_tbel_3649, retro_tbel_3665, retro_tbel_3831, retro_tbel_3839, retro_tbel_3840, retro_tbel_3874, retro_tbel_3920, retro_tbel_396, retro_tbel_3977, retro_tbel_4021, retro_tbel_4053, retro_tbel_4133, retro_tbel_4149, retro_tbel_4224, retro_tbel_426, retro_tbel_4284, retro_tbel_4305, retro_tbel_4313, retro_tbel_4474, retro_tbel_4484, retro_tbel_4498, retro_tbel_4499, retro_tbel_4502, retro_tbel_4504, retro_tbel_4547, retro_tbel_4554, retro_tbel_4565, retro_tbel_4628, retro_tbel_703, retro_tbel_709, retro_tbel_763, retro_tbel_843, retro_tbel_866, retro_tbel_871, retro_tbel_874,
Tarsius syrichta ENSTSYG0000000084514 retrocopies
Tursiops truncatus ENSTTRG000000139475 retrocopies



Copyright © RetrogeneDB 2014-2017